How to Explain DNA to Kids - Owlcation - Education
Updated date:

How to Explain DNA to Kids

Author:

Rhys Baker teaches science at Arthur Mellows Village College in Peterborough, UK.

The Secret of Life - the DNA double Helix

The Secret of Life - the DNA double Helix

DNA stands for deoxyribonucleic acid and is one of the two types of nucleic acid found in our cells. The name describes what the molecule is.

DNA is beautifully intricate and works in complicated mechanisms to control the cell.

As a teacher, I am a strong believer that you can teach anyone, anything. The younger the student, the more likely they are to retain it. So, let us take a look at how you would explain DNA to a six-year-old.

Did You Know?

DNA is a nucleic acid (i.e. it is made up of strings of nucleotides bonded together) that has a backbone made of phosphate and deoxyribose

We are all made of trillions of cells. There are around 2.5 billion cells in one of your hands, but they are tiny. So tiny that we cannot see them. If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus!

Each cell has its own job, just like humans do. Some cells help us detect light and see, other cells help us touch, some cells help us hear, other cells carry oxygen around, other cells help us digest food by secreting enzymes. There are over 200 cell types in the body - that is 200 different jobs!

But how does each cell know what job to do ? Well how do we (humans) know what job to do? Someone tells us. Our cells are also told what to do, but not by a person or a computer! Our cells are told what to do by a very special molecule called DNA.

Fun Fact

If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus!

DNA is a record of instructions telling the cell what its job is going to be. A good analogy for DNA as a whole is a set of blueprints for the cell, or computer code telling a PC what to do. It is written in a special alphabet that is only four letters long! Unlike a book or computer screen, DNA isn't flat and boring - it is a beautiful curved ladder. We call this shape a double helix. The letters of the DNA alphabet (called bases) make up the rungs, special sugars and other atoms make up the handrail.

The rungs are very special. Each one has a name, but they prefer to be called by their initials: A, T, C and G They don't like to be by themselves so they always pair up with a friend. But they are very choosy about their friends:

  • A and T are best friends and always hang out together
  • G and C are best friends and always hang out together

Another way of looking at it is that A, T, G and C are like jigsaw pieces. A and T fit together, C and G fit together. You cannot force a puzzle piece into the wrong place!

Think of all the words you can spell. I bet there are loads. But each word is made using the same selection of letters. Yes, sometimes we leave letters out, sometimes we repeat letters, but we always have the same selection of letters. Depending on how we arrange the letters of the alphabet we can make new words. The same is true in the four letter alphabet of DNA.

If you look at a length of DNA, you can read out the letters all in a row:

ATGCGTGGTCAGTCGATATATGGCCCC

These letters make up words that are always three letters long. These are called codons.

ATG CGT GGT CAG TCG ATA TAT GGC CCC

These words make up sentences that the cell understands. These sentences are called genes.

[ATG CGT GGT CAG] [TCG ATA TAT GGC CCC]

Each sentence tells a cell to make a special molecule called a protein. These proteins control everything in a cell. In this way, DNA is like the boss of a company, and not the brain of the cell. It issues instructions, but doesn't do very much of the actual work :) These proteins help each cell do its job. Each gene makes one protein, and only one protein.

Build a lego tower 10 blocks tall. Use only 4 colours. How many combinations can you make? This is how DNA can store so much information with just 4 letters in its' alphabet

Build a lego tower 10 blocks tall. Use only 4 colours. How many combinations can you make? This is how DNA can store so much information with just 4 letters in its' alphabet

How can four letters make something as complicated as a human body? Let us take a trip back to my favourite childhood toy—Lego.

Give a child 80 pieces of one colour and ask them to build a tower. No matter how they try, they can only make one possible combination of colours.

Now give a child a box of Lego with 20 lots of 4 different colours and ask them to make a tower. The size is still the same, but the combination and order of colours is different each time they build. The possibilities are endless...well not quite, but still quite large.

Remember it is the sequence of letters (order of the colours in this analogy) that stores the information. Each set of 3 letters is a word. With four different letters, there are 64 possible three-letter-words. Imagine how many combinations of these words there are in a sentence just 100 letters long!

I hope this has shown you that the basics of DNA are simple and straightforward. Whenever you are trying to convey complex ideas to young children, analogies are your friend. Just make sure they know what the analogy means, and they are not just saying "DNA is like Lego" or "cells are like buses."

Let me know if this was useful, and please comment and give feedback.

Where Next? DNA Basics

  • BBC - Norfolk Kids - Science A-Z: DNA
    Website from the BBC looking at DNA and it's importance. Ok it is a little UK-centric but shows how DNA is of importance to all aspects of Biology. Some good links here too

Comments

chihan on March 03, 2020:

fascinating

Chengcheng Fei on February 23, 2020:

I am a nine-year-old Chinese boy from Being.I found this article very fascinating!I am going to make a video based on your article, and post it on Douyin , our Chinese YouTube!Thank you very much for your beautiful article!

Fox on January 29, 2020:

Thank You! It was the best ever! I could understand everything! I will get a good mark for my project

Wolf on January 19, 2020:

Really cool but I couldn’t really understand the condones and letters:(

Chinmay Aggarwal on November 16, 2019:

It was perfect. I understood it so well that I can even explain it to my friends. And I don't think that this content can only be used by a six year old kid.

Cooper Luck on November 05, 2019:

Totally a website for a 6 yr old "DNA stands for deoxyribonucleic acid and is one of the two types of nucleic acid found in our cells. The name describes what the molecule is." Bruh.

Holden on November 05, 2019:

i was kinda bored reading this. maybe make a more detailed one for students?

SteveRoller on September 21, 2019:

Now Steve Rogers

Simon on August 11, 2019:

LOt of information

fkfrvcevsfsabhdbfhsbshdesfgdcgfosuhdswscdxevvbvkf on August 11, 2019:

Good job

BK Nyland on March 09, 2019:

The DNA holds or stores the information using code in various forms, configurations, instructing cells what to do. Yes the DNA sends out instructions, ( or "tells" other celss what to do etc.. like a computer program can tell a robot what to do or carry out multiple functions. My question still remaining is... information came from an intelligent mind... not the physical data that it holds like DNA holds the information, it can copy the information.. but DNA did not code itself...it received the instructions.. no matter how long ago from a mind or an intelligent designer. Does ANYONE on this site agree? I have not seen anyone else question this.

Sami M. on January 15, 2019:

It is really amazing information about DNA and it's very complicated to understand it but at least I've got an idea how dna works in our body, thank you for this introducing in very simple words and way , great job thanks again

Bruh on December 16, 2018:

Yah so cool

Bede from Minnesota on April 16, 2018:

Rhys, I’ve been meaning to say “thanks” for this article. I stumbled into Hub Pages via this article, and decided to join the gang, as it were. The fun fact about the school bus is very memorable.

tara on April 10, 2018:

science

Princess Diana on April 09, 2018:

Wow I learned a lot!

Sara on April 03, 2018:

Wow! You have talent! So clear and I love the analogies

Bethany on March 22, 2018:

Thank you so much! This is awesome and very well thought out! I appreciate all of the helpful analogies and will even use some of this when teaching middle schoolers! Great job!

Me on March 19, 2018:

What is T G A and C made of?

karis on February 12, 2018:

i love science

doctor squish on February 04, 2018:

you need to explain more.

Mary on January 30, 2018:

Thank you for doing this

bunnygurl18 on January 13, 2018:

This was very interesting! I have an assignment about cells and I have to write a script (that I will probably need to read and use), that explains an animal cell, a plant cell, and a simple bacterial cell, to a 3rd grader. This article really helps me to explain the DNA that is in these cells. Thank you for taking your time to write this article to help me and many others about this topic!

IEn on January 11, 2018:

This was very interesting I personally did not know very much about DNA and the information presented was not to complicated (that is if you have the attention span to finish reading it) thank you.

clark kent on January 11, 2018:

I LIKE it

ethasn on January 10, 2018:

i like this

. on December 13, 2017:

yes, actually

DNA is fake on December 06, 2017:

I think this because has any body seen DNA?

............ on November 30, 2017:

i am a student and 7 i thought i was smart

thx

Taffy on November 30, 2017:

need more info for my project

j on October 17, 2017:

good

Steve on September 28, 2017:

Excellent explanation. I'd also like to know how DNA modification works, i.e. how are all of the bodies DNA molecules changed.

kelper22 on September 26, 2017:

I lerned a lot

Sarah on September 20, 2017:

This really helped teach my austistic so about dna

young waqs on September 20, 2017:

very good

Anja on September 18, 2017:

This site helped me with my asinmint.

Educator on August 22, 2017:

For this being a site to help teach something, you would think someone would think twice about having an advertisement from Astroglide lubricant.

Anand raj on August 18, 2017:

Thanks too much

susansylke@gmail.com on August 09, 2017:

This is fabulous thank you for sharing

..... on May 04, 2017:

one question does the amount of DNA tell the age of a human?

Thankyou,I have to give a talk to 70-90 year olds, this explains it so easily on January 08, 2017:

I am 70 years old and my talk will be to educated people 20-35 years older than me. They love pictures and simplicity to keep them focused, thankyou

Mary on November 05, 2016:

Thanks for making Biology easier!

Jacquelyn on October 25, 2016:

love your explanation. Since i am a student this really helped me get a better understanding of DNA. i will definitely use this in my project.

thx

sujit karna on October 18, 2016:

The topic of DNA is really very complicated and for a teacher it is very difficult to explain.Your explaination is very simple and easily

understandable.

Keara on April 07, 2016:

Good explanation, but I was a little distressed by the part of the analogy that says people know what work to do because "someone tells us." That statement makes people sound like robots and that we do not make decisions on our own. Maybe this is lost on me because I work for myself, but this paints the picture of a chain of people telling other people what to do and everyone following blindly. Something to think about when discussing this concept with children! Humans have free will... :)

Cc on February 24, 2016:

As a physician,cancer researcher thank you for the wonderful article. I can't believe how easy it made it to explain molecular biology to my eleven year old nephew. I wish he (and some medical students) had you as a teacher. He especially liked the Legos!

Sheena on January 31, 2016:

I am really impressed by your way of explanation . Thanks!

Ifty Ahmed on December 09, 2015:

"With four different letters, there are 64 possible three-letter-words". - you may want to check the math here - i think with 4 different letters, there are only 24 3-letter words possible. But I could be wrong....

TheNamesAreGood on September 21, 2015:

people put more funny names

poop on September 15, 2015:

boring

merpity derp on August 23, 2015:

merpity derp

Jainmonika.ba@gmail.com on June 03, 2015:

My kid asks how come I have your DNA and Dads DNA when I was not in his tummy . He insists on searching on net , how to explain ?

Spencer on January 26, 2015:

I'm 11 and totally understand DNA now thank you so much

dcraig on September 03, 2014:

haha peeps

kashaf on August 20, 2014:

Thanx for beautifull knowledge but i can't understand the that sentences

Rebecca Sutton from Rock Hill, SC on August 02, 2014:

Much needed hub! I am an adult and this helped :) Wish I had it last semester. Thanks!

arthur on July 16, 2014:

contact with e-mail arthur-fortes@hotmail.com

arthur on July 16, 2014:

hello, I'm brazilian and I want to use your post as inspiration for a science fair, just use your way to explain the DNA, I'll share your page e show the source of the explanation, your page, I just wanna say thanks for inspire me and I hope your permition to use some of your informations

pop on April 07, 2014:

I think your right when you say you can teach almost anyone nearly anything if you know how to teach I was doing self study about the difference between Prokaryotic Cells and Eukaryotic cells halfway through first year and BELIEVE ME when I say I wasn't very hard working or intelligent

jimmytrust on February 19, 2014:

Nice. Simple and sweet. Good for adults like me who are not interested in a biology degree. Lol.

     

“If you can't explain it simply, you don't understand it well enough"

I understand someone famous said those words.

Keep the good work. Maybe something for teenagers

Rhys Baker (author) from Peterborough, UK on October 23, 2013:

@monika

I am well aware of alternative splicing, capping and such. This is an explanation for kids around six, and answered a specific question i was asked. It doesn't need to be accurate to degree level.

I'm glad you like the article. I've since sold a version of it on!

Monika on October 17, 2013:

Wow thanks, it's veeeery useful, but you can pass this part with gene coding one and only one protein (alternative splicing).

innmnmn on October 11, 2013:

awesome

Dennis A. Rivera on September 19, 2013:

I'm a science teacher in Ecuador. This helped a lot, thanks so much

Emily on September 02, 2013:

Can you tell me who owns the double helix icon that gives the chemical bases that is on this page? I would like to use it for a book I'm writing. Thank you.

Jibin on August 15, 2013:

Beautiful explanation... Thank you

mariam mamdouh on July 23, 2013:

really amazing ,, thanks you

Claire from Lincolnshire, UK on July 18, 2013:

This is great, thank you. My 6 year old son asked about DNA today and this is perfect for explaining it to him.

denisefenimore on July 11, 2013:

Awesome job! It's not just for kids either. Really helped me understand DNA in a simple manner.

DR RAMA on May 17, 2013:

It was fantastic

pinkpaki22 on April 29, 2013:

wow this really came in handy for my science fair thank you :)

pookieface12 on April 16, 2013:

thx fo the info... i neeed it for my essay... thx again!!!!

Rhys Baker (author) from Peterborough, UK on April 16, 2013:

Thanks for the correction-I can't seem to edit the comment though! I'm glad you found the information useful

Brian W on April 15, 2013:

Thanks so much for this resource! I'm a scientist in America who has to regularly communicate my research to a general audience, and today I faced a new challenge in trying to explain DNA to a group of 4-year-olds. This article provided me with some good talking points and I think that they learned some good stuff about their DNA.

Just to correct a small typo from one of the author comments above, the last letter in the OPPOSITE DNA strand should be a T, not an A. So, for the strand reading

AAACTGCCGCGGTTATTATATTCGCGA

the complimentary strand would read

TTTGACGGCGCCAATAATATAAGCGCT.

Rhys Baker (author) from Peterborough, UK on April 04, 2013:

Because they don't pair along the line like that, they pair up in opposite strands. For example, a typical DNA strand could read

AAACTGCCGCGGTTATTATATTCGCGA.

The strand does not pair linearly. The OPPOSITE DNA stand (remember DNA is a double helix with two strands wrapped around each other) would read:

TTTGACGGCGCCAATAATATAAGCGCA.

These strands are read in groups of three to form words which are then made into proteins by the cell's construction workbench-the ribosome.

Take a closer look at the last diagram above to clear this up.

sebastienrivas on April 03, 2013:

Hello,

Thanks a bunch for breaking everything down and making it possible to understand for children and for adults too!

Although I still have a question.

If A is paired with T and C is paired with G (jigsaw combination). Why can we find "GT...GG...CC and a single letter C" at the end of the sentence formation AT GC GT GG TC AG TC GA TA TA TG GC CC C?

Thanks,

Seb

Ramzie on February 21, 2013:

What an amazing thing! DNA is made from inside the cell.

Doug,Leicester on February 16, 2013:

Been watching ,struggling with that brilliant TV series with physycist Brian Cox.He is slightly over my head but your child learning section has helped an 80 year old get a handle on DNA.Thankyou so much.I shall now read more advanced articles.

Sylvia Austin on December 04, 2012:

Hi,I'm a parent that has been looking for an easy way to help my nine year old explain his DNA double Helix science project, this is perfect Thank you so much.

lana on November 21, 2012:

I'm a parent , and it took me so much time to find a simple way to explain DNA for my 7 years daughter . finally this explanation for DNA is soooooo great thanks a lot .

sania on October 12, 2012:

hi this gives me a good information for science in year 7

Sciencewiz on September 29, 2012:

Thanks a bunch!

Rhys Baker (author) from Peterborough, UK on September 29, 2012:

DNA doesn't get into cells, it builds cells around itself. And yes, apart from the sex cells which have half the DNA, all of your somatic (body) cells have the same compliment of DNA

Sciencewiz on September 29, 2012:

Hi! Thanks so much for this, I always taught that DNA was confusing, but it really isn't! I just had one question, does each cell contain equal amount of DNA, and how does DNA get into cells?

pinkhawk from Pearl of the Orient on June 19, 2012:

Wow! This is very educational, wish I could explain things like this... thank you for this useful article. ^_^!

CJacksonSmith from Dudley on June 18, 2012:

Very Nice, I wish you had taught me about DNA would have understood a lot sooner!

Rhys Baker (author) from Peterborough, UK on June 14, 2012:

@sarahmoose: I'm delighted that you found it useful, and that your tutees said it made sense. The more this information gets passed around the faster we shall show the world that science isn't mysterious or inexplicable but straightforward.

Thanks for stopping by!

Sarah Chewings from Nottingham, England on June 14, 2012:

I found this resource really useful. I tutor GCSE students in science, and a couple of students struggled with the theory. When I used this, they said it all made sense, so thank you!!

Rhys Baker (author) from Peterborough, UK on March 04, 2012:

Thank-you, AliciaC. I am a firm believer that with the right tools you can teach anyone anything. I am glad you found it interesting. Thanks for stopping by!

Linda Crampton from British Columbia, Canada on March 03, 2012:

This is a useful and interesting hub, TFScientist. You've described some good ways to explain what DNA is to young children!

StellaSee from California on February 11, 2012:

I liked the lego analogy you use here. I think I'll be thinking about this article when I take my molecular biology class! Thanks for sharing!

knottlena from Connecticut on January 12, 2012:

I am so blown away by the way you wrote this, I am nearly speechless. Thank you for the excellent read.

Rhys Baker (author) from Peterborough, UK on January 12, 2012:

Thanks for the praise, Krystal. I really enjoyed writing a hub knowing that someone was looking for that answer - it was lots of fun! Let me know if there are any other topics you want covering.

I am so pleased my hub was helpful to your class! Don't forget to check out the links because they can really help understanding - certainly the animation does.

Lady_E Thanks for your positive comment.

Both of these have made my day!

Elena from London, UK on January 12, 2012:

Very useful to know. I like the way you explained. I'm sure a little one will ask me at some point.... I'll just print this out. Cheers.

Krystal from Los Angeles on January 11, 2012:

AWESOME job TF! This really answered my question thoroughly! This came up when I was studying the ocean with my students. We found out that every living organism in the ocean had its own unique DNA but that they can be grouped by their similarities.

One inquisitive student wanted to know more about DNA! I came equipped with a print-out of your article today and shared with the class. Lo and behold, they were fascinated! When we wrap up this study we have decided to move on to a study of DNA. I was even planned a trip to CalTech Poly where we will look at DNA using microscopes!

I never thought I would get this kind of inspiration from hubpages and I thank you for your willingness to share your knowledge!

Rhys Baker (author) from Peterborough, UK on January 11, 2012:

I like that with just one exception - the copying of DNA is remarkably accurate (equivalent of copying out encyclopaedia britannica several times with no mistakes) and Protein synthesis is even more accurate. If this weren't true, the organism would swiftly die. Variation, both inter and intra species, is caused by quite different processes - namely crossing over and random assortment of chromsomes during meiosis and then recombination during fertilisation. But I like the storage and pages part of the analogy

sms2011 from Stockton on January 11, 2012:

I once heard someone explain DNA as being like a cake recipe book in a library. You can take the book out of the library and even unravel it by taking out the pages. You follow the cake recipes inside the book but when ever you make the cake it never turns out quite the same way twice. When you've finished you have to return the recipe book to the library because that is where its stored. Made sense to me at the time

Related Articles