How to Explain DNA to Kids

Updated on November 30, 2016
The Secret of Life - the DNA double Helix
The Secret of Life - the DNA double Helix

DNA Made Simple

DNA stands for deoxyribonucleic acid and is one of the two types of nucleic acid found in our cells. The name describes what the molecule is.

DNA is beautifully intricate and works in complicated mechanisms to control the cell.

As a teacher, I am a strong believer that you can teach anyone, anything. The younger the student, the more likely they are to retain it. So, let us take a look at how you would explain DNA to a six-year-old.

Did You Know?

DNA is a nucleic acid (i.e. it is made up of strings of nucleotides bonded together) that has a backbone made of phosphate and deoxyribose

Cells—The Building Blocks of Life

We are all made of trillions of cells. There are around 2.5 billion cells in one of your hands, but they are tiny. So tiny that we cannot see them. If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus!

Each cell has its own job, just like humans do. Some cells help us detect light and see, other cells help us touch, some cells help us hear, other cells carry oxygen around, other cells help us digest food by secreting enzymes. There are over 200 cell types in the body - that is 200 different jobs!

But how does each cell know what job to do ? Well how do we (humans) know what job to do? Someone tells us. Our cells are also told what to do, but not by a person or a computer! Our cells are told what to do by a very special molecule called DNA.

Fun Fact

If every cell in your hand was the size of a grain of sand, your hand would be the size of a school bus!

Click thumbnail to view full-size
The alphabet rungs will only pair up in a certain way - just like a jigsaw puzzleThe DNA Double HelixComputer animation of DNA showing what it looks like in real space - not quite as slim as the last one!
The alphabet rungs will only pair up in a certain way - just like a jigsaw puzzle
The alphabet rungs will only pair up in a certain way - just like a jigsaw puzzle | Source
The DNA Double Helix
The DNA Double Helix
Computer animation of DNA showing what it looks like in real space - not quite as slim as the last one!
Computer animation of DNA showing what it looks like in real space - not quite as slim as the last one! | Source

DNA—Life's Instruction Manual

DNA is a record of instructions telling the cell what its job is going to be. A good analogy for DNA as a whole is a set of blueprints for the cell, or computer code telling a PC what to do. It is written in a special alphabet that is only four letters long! Unlike a book or computer screen, DNA isn't flat and boring - it is a beautiful curved ladder. We call this shape a double helix. The letters of the DNA alphabet (called bases) make up the rungs, special sugars and other atoms make up the handrail.

The rungs are very special. Each one has a name, but they prefer to be called by their initials: A, T, C and G They don't like to be by themselves so they always pair up with a friend. But they are very choosy about their friends:

  • A and T are best friends and always hang out together
  • G and C are best friends and always hang out together

Another way of looking at it is that A, T, G and C are like jigsaw pieces. A and T fit together, C and G fit together. You cannot force a puzzle piece into the wrong place!

Four Letter Alphabet

Think of all the words you can spell. I bet there are loads. But each word is made using the same selection of letters. Yes, sometimes we leave letters out, sometimes we repeat letters, but we always have the same selection of letters. Depending on how we arrange the letters of the alphabet we can make new words. The same is true in the four letter alphabet of DNA.

If you look at a length of DNA, you can read out the letters all in a row:

ATGCGTGGTCAGTCGATATATGGCCCC

These letters make up words that are always three letters long. These are called codons.

ATG CGT GGT CAG TCG ATA TAT GGC CCC

These words make up sentences that the cell understands. These sentences are called genes.

[ATG CGT GGT CAG] [TCG ATA TAT GGC CCC]

Each sentence tells a cell to make a special molecule called a protein. These proteins control everything in a cell. In this way, DNA is like the boss of a company, and not the brain of the cell. It issues instructions, but doesn't do very much of the actual work :) These proteins help each cell do its job. Each gene makes one protein, and only one protein.

Build a lego tower 10 blocks tall. Use only 4 colours. How many combinations can you make? This is how DNA can store so much information with just 4 letters in its' alphabet
Build a lego tower 10 blocks tall. Use only 4 colours. How many combinations can you make? This is how DNA can store so much information with just 4 letters in its' alphabet

Just Four Letters?

How can four letters make something as complicated as a human body? Let us take a trip back to my favourite childhood toy—Lego.

Give a child 80 pieces of one colour and ask them to build a tower. No matter how they try, they can only make one possible combination of colours.

Now give a child a box of Lego with 20 lots of 4 different colours and ask them to make a tower. The size is still the same, but the combination and order of colours is different each time they build. The possibilities are endless...well not quite, but still quite large.

Remember it is the sequence of letters (order of the colours in this analogy) that stores the information. Each set of 3 letters is a word. With four different letters, there are 64 possible three-letter-words. Imagine how many combinations of these words there are in a sentence just 100 letters long!

DNA Elegantly Simple, Wickedly Complicated

I hope this has shown you that the basics of DNA are simple and straightforward. Whenever you are trying to convey complex ideas to young children, analogies are your friend. Just make sure they know what the analogy means, and they are not just saying "DNA is like Lego" or "cells are like buses."

Let me know if this was useful, and please comment and give feedback.

Questions & Answers

    Comments

      0 of 8192 characters used
      Post Comment

      • Bede le Venerable profile image

        Bede 5 weeks ago from Minnesota

        Rhys, I’ve been meaning to say “thanks” for this article. I stumbled into Hub Pages via this article, and decided to join the gang, as it were. The fun fact about the school bus is very memorable.

      • profile image

        tara 6 weeks ago

        science

      • profile image

        Princess Diana 6 weeks ago

        Wow I learned a lot!

      • profile image

        Sara 7 weeks ago

        Wow! You have talent! So clear and I love the analogies

      • profile image

        Bethany 2 months ago

        Thank you so much! This is awesome and very well thought out! I appreciate all of the helpful analogies and will even use some of this when teaching middle schoolers! Great job!

      • profile image

        Me 2 months ago

        What is T G A and C made of?

      • profile image

        karis 3 months ago

        i love science

      • profile image

        doctor squish 3 months ago

        you need to explain more.

      • profile image

        Mary 3 months ago

        Thank you for doing this

      • profile image

        bunnygurl18 4 months ago

        This was very interesting! I have an assignment about cells and I have to write a script (that I will probably need to read and use), that explains an animal cell, a plant cell, and a simple bacterial cell, to a 3rd grader. This article really helps me to explain the DNA that is in these cells. Thank you for taking your time to write this article to help me and many others about this topic!

      • profile image

        IEn 4 months ago

        This was very interesting I personally did not know very much about DNA and the information presented was not to complicated (that is if you have the attention span to finish reading it) thank you.

      • profile image

        clark kent 4 months ago

        I LIKE it

      • profile image

        ethasn 4 months ago

        i like this

      • profile image

        5 months ago

        yes, actually

      • profile image

        DNA is fake 5 months ago

        I think this because has any body seen DNA?

      • profile image

        ............ 5 months ago

        i am a student and 7 i thought i was smart

        thx

      • profile image

        Taffy 5 months ago

        need more info for my project

      • profile image

        7 months ago

        good

      • profile image

        Steve 7 months ago

        Excellent explanation. I'd also like to know how DNA modification works, i.e. how are all of the bodies DNA molecules changed.

      • profile image

        kelper22 8 months ago

        I lerned a lot

      • profile image

        Sarah 8 months ago

        This really helped teach my austistic so about dna

      • profile image

        young waqs 8 months ago

        very good

      • profile image

        Anja 8 months ago

        This site helped me with my asinmint.

      • profile image

        Educator 9 months ago

        For this being a site to help teach something, you would think someone would think twice about having an advertisement from Astroglide lubricant.

      • profile image

        Anand raj 9 months ago

        Thanks too much

      • profile image

        susansylke@gmail.com 9 months ago

        This is fabulous thank you for sharing

      • profile image

        ..... 12 months ago

        one question does the amount of DNA tell the age of a human?

      • profile image

        Thankyou,I have to give a talk to 70-90 year olds, this explains it so easily 16 months ago

        I am 70 years old and my talk will be to educated people 20-35 years older than me. They love pictures and simplicity to keep them focused, thankyou

      • profile image

        Mary 18 months ago

        Thanks for making Biology easier!

      • profile image

        Jacquelyn 19 months ago

        love your explanation. Since i am a student this really helped me get a better understanding of DNA. i will definitely use this in my project.

        thx

      • profile image

        sujit karna 19 months ago

        The topic of DNA is really very complicated and for a teacher it is very difficult to explain.Your explaination is very simple and easily

        understandable.

      • profile image

        Keara 2 years ago

        Good explanation, but I was a little distressed by the part of the analogy that says people know what work to do because "someone tells us." That statement makes people sound like robots and that we do not make decisions on our own. Maybe this is lost on me because I work for myself, but this paints the picture of a chain of people telling other people what to do and everyone following blindly. Something to think about when discussing this concept with children! Humans have free will... :)

      • profile image

        Cc 2 years ago

        As a physician,cancer researcher thank you for the wonderful article. I can't believe how easy it made it to explain molecular biology to my eleven year old nephew. I wish he (and some medical students) had you as a teacher. He especially liked the Legos!

      • profile image

        Sheena 2 years ago

        I am really impressed by your way of explanation . Thanks!

      • profile image

        Ifty Ahmed 2 years ago

        "With four different letters, there are 64 possible three-letter-words". - you may want to check the math here - i think with 4 different letters, there are only 24 3-letter words possible. But I could be wrong....

      • profile image

        TheNamesAreGood 2 years ago

        people put more funny names

      • profile image

        poop 2 years ago

        boring

      • profile image

        merpity derp 2 years ago

        merpity derp

      • profile image

        Jainmonika.ba@gmail.com 2 years ago

        My kid asks how come I have your DNA and Dads DNA when I was not in his tummy . He insists on searching on net , how to explain ?

      • profile image

        Spencer 3 years ago

        I'm 11 and totally understand DNA now thank you so much

      • profile image

        dcraig 3 years ago

        haha peeps

      • profile image

        kashaf 3 years ago

        Thanx for beautifull knowledge but i can't understand the that sentences

      • Rebeccasutton profile image

        Rebecca Sutton 3 years ago from Rock Hill, SC

        Much needed hub! I am an adult and this helped :) Wish I had it last semester. Thanks!

      • profile image

        arthur 3 years ago

        contact with e-mail arthur-fortes@hotmail.com

      • profile image

        arthur 3 years ago

        hello, I'm brazilian and I want to use your post as inspiration for a science fair, just use your way to explain the DNA, I'll share your page e show the source of the explanation, your page, I just wanna say thanks for inspire me and I hope your permition to use some of your informations

      • profile image

        pop 4 years ago

        I think your right when you say you can teach almost anyone nearly anything if you know how to teach I was doing self study about the difference between Prokaryotic Cells and Eukaryotic cells halfway through first year and BELIEVE ME when I say I wasn't very hard working or intelligent

      • profile image

        jimmytrust 4 years ago

        Nice. Simple and sweet. Good for adults like me who are not interested in a biology degree. Lol.

             

        “If you can't explain it simply, you don't understand it well enough"

        I understand someone famous said those words.

        Keep the good work. Maybe something for teenagers

      • TFScientist profile image
        Author

        Rhys Baker 4 years ago from Peterborough, UK

        @monika

        I am well aware of alternative splicing, capping and such. This is an explanation for kids around six, and answered a specific question i was asked. It doesn't need to be accurate to degree level.

        I'm glad you like the article. I've since sold a version of it on!

      • profile image

        Monika 4 years ago

        Wow thanks, it's veeeery useful, but you can pass this part with gene coding one and only one protein (alternative splicing).

      • profile image

        innmnmn 4 years ago

        awesome

      • profile image

        Dennis A. Rivera 4 years ago

        I'm a science teacher in Ecuador. This helped a lot, thanks so much

      • profile image

        Emily 4 years ago

        Can you tell me who owns the double helix icon that gives the chemical bases that is on this page? I would like to use it for a book I'm writing. Thank you.

      • profile image

        Jibin 4 years ago

        Beautiful explanation... Thank you

      • profile image

        mariam mamdouh 4 years ago

        really amazing ,, thanks you

      • Elderberry Arts profile image

        Claire 4 years ago from Surrey, Uk

        This is great, thank you. My 6 year old son asked about DNA today and this is perfect for explaining it to him.

      • profile image

        denisefenimore 4 years ago

        Awesome job! It's not just for kids either. Really helped me understand DNA in a simple manner.

      • profile image

        DR RAMA 5 years ago

        It was fantastic

      • profile image

        pinkpaki22 5 years ago

        wow this really came in handy for my science fair thank you :)

      • profile image

        pookieface12 5 years ago

        thx fo the info... i neeed it for my essay... thx again!!!!

      • TFScientist profile image
        Author

        Rhys Baker 5 years ago from Peterborough, UK

        Thanks for the correction-I can't seem to edit the comment though! I'm glad you found the information useful

      • profile image

        Brian W 5 years ago

        Thanks so much for this resource! I'm a scientist in America who has to regularly communicate my research to a general audience, and today I faced a new challenge in trying to explain DNA to a group of 4-year-olds. This article provided me with some good talking points and I think that they learned some good stuff about their DNA.

        Just to correct a small typo from one of the author comments above, the last letter in the OPPOSITE DNA strand should be a T, not an A. So, for the strand reading

        AAACTGCCGCGGTTATTATATTCGCGA

        the complimentary strand would read

        TTTGACGGCGCCAATAATATAAGCGCT.

      • TFScientist profile image
        Author

        Rhys Baker 5 years ago from Peterborough, UK

        Because they don't pair along the line like that, they pair up in opposite strands. For example, a typical DNA strand could read

        AAACTGCCGCGGTTATTATATTCGCGA.

        The strand does not pair linearly. The OPPOSITE DNA stand (remember DNA is a double helix with two strands wrapped around each other) would read:

        TTTGACGGCGCCAATAATATAAGCGCA.

        These strands are read in groups of three to form words which are then made into proteins by the cell's construction workbench-the ribosome.

        Take a closer look at the last diagram above to clear this up.

      • profile image

        sebastienrivas 5 years ago

        Hello,

        Thanks a bunch for breaking everything down and making it possible to understand for children and for adults too!

        Although I still have a question.

        If A is paired with T and C is paired with G (jigsaw combination). Why can we find "GT...GG...CC and a single letter C" at the end of the sentence formation AT GC GT GG TC AG TC GA TA TA TG GC CC C?

        Thanks,

        Seb

      • profile image

        Ramzie 5 years ago

        What an amazing thing! DNA is made from inside the cell.

      • profile image

        Doug,Leicester 5 years ago

        Been watching ,struggling with that brilliant TV series with physycist Brian Cox.He is slightly over my head but your child learning section has helped an 80 year old get a handle on DNA.Thankyou so much.I shall now read more advanced articles.

      • profile image

        Sylvia Austin 5 years ago

        Hi,I'm a parent that has been looking for an easy way to help my nine year old explain his DNA double Helix science project, this is perfect Thank you so much.

      • profile image

        lana 5 years ago

        I'm a parent , and it took me so much time to find a simple way to explain DNA for my 7 years daughter . finally this explanation for DNA is soooooo great thanks a lot .

      • profile image

        sania 5 years ago

        hi this gives me a good information for science in year 7

      • profile image

        Sciencewiz 5 years ago

        Thanks a bunch!

      • TFScientist profile image
        Author

        Rhys Baker 5 years ago from Peterborough, UK

        DNA doesn't get into cells, it builds cells around itself. And yes, apart from the sex cells which have half the DNA, all of your somatic (body) cells have the same compliment of DNA

      • profile image

        Sciencewiz 5 years ago

        Hi! Thanks so much for this, I always taught that DNA was confusing, but it really isn't! I just had one question, does each cell contain equal amount of DNA, and how does DNA get into cells?

      • pinkhawk profile image

        pinkhawk 5 years ago from Pearl of the Orient

        Wow! This is very educational, wish I could explain things like this... thank you for this useful article. ^_^!

      • CJacksonSmith profile image

        CJacksonSmith 5 years ago from Dudley

        Very Nice, I wish you had taught me about DNA would have understood a lot sooner!

      • TFScientist profile image
        Author

        Rhys Baker 5 years ago from Peterborough, UK

        @sarahmoose: I'm delighted that you found it useful, and that your tutees said it made sense. The more this information gets passed around the faster we shall show the world that science isn't mysterious or inexplicable but straightforward.

        Thanks for stopping by!

      • sarahmoose profile image

        Sarah Chewings 5 years ago from Nottingham, England

        I found this resource really useful. I tutor GCSE students in science, and a couple of students struggled with the theory. When I used this, they said it all made sense, so thank you!!

      • TFScientist profile image
        Author

        Rhys Baker 6 years ago from Peterborough, UK

        Thank-you, AliciaC. I am a firm believer that with the right tools you can teach anyone anything. I am glad you found it interesting. Thanks for stopping by!

      • AliciaC profile image

        Linda Crampton 6 years ago from British Columbia, Canada

        This is a useful and interesting hub, TFScientist. You've described some good ways to explain what DNA is to young children!

      • StellaSee profile image

        StellaSee 6 years ago from California

        I liked the lego analogy you use here. I think I'll be thinking about this article when I take my molecular biology class! Thanks for sharing!

      • knottlena profile image

        knottlena 6 years ago from Connecticut

        I am so blown away by the way you wrote this, I am nearly speechless. Thank you for the excellent read.

      • TFScientist profile image
        Author

        Rhys Baker 6 years ago from Peterborough, UK

        Thanks for the praise, Krystal. I really enjoyed writing a hub knowing that someone was looking for that answer - it was lots of fun! Let me know if there are any other topics you want covering.

        I am so pleased my hub was helpful to your class! Don't forget to check out the links because they can really help understanding - certainly the animation does.

        Lady_E Thanks for your positive comment.

        Both of these have made my day!

      • Lady_E profile image

        Elena 6 years ago from London, UK

        Very useful to know. I like the way you explained. I'm sure a little one will ask me at some point.... I'll just print this out. Cheers.

      • KrystalD profile image

        KrystalD 6 years ago from Los Angeles

        AWESOME job TF! This really answered my question thoroughly! This came up when I was studying the ocean with my students. We found out that every living organism in the ocean had its own unique DNA but that they can be grouped by their similarities.

        One inquisitive student wanted to know more about DNA! I came equipped with a print-out of your article today and shared with the class. Lo and behold, they were fascinated! When we wrap up this study we have decided to move on to a study of DNA. I was even planned a trip to CalTech Poly where we will look at DNA using microscopes!

        I never thought I would get this kind of inspiration from hubpages and I thank you for your willingness to share your knowledge!

      • TFScientist profile image
        Author

        Rhys Baker 6 years ago from Peterborough, UK

        I like that with just one exception - the copying of DNA is remarkably accurate (equivalent of copying out encyclopaedia britannica several times with no mistakes) and Protein synthesis is even more accurate. If this weren't true, the organism would swiftly die. Variation, both inter and intra species, is caused by quite different processes - namely crossing over and random assortment of chromsomes during meiosis and then recombination during fertilisation. But I like the storage and pages part of the analogy

      • sms2011 profile image

        sms2011 6 years ago from Stockton

        I once heard someone explain DNA as being like a cake recipe book in a library. You can take the book out of the library and even unravel it by taking out the pages. You follow the cake recipes inside the book but when ever you make the cake it never turns out quite the same way twice. When you've finished you have to return the recipe book to the library because that is where its stored. Made sense to me at the time

      working

      This website uses cookies

      As a user in the EEA, your approval is needed on a few things. To provide a better website experience, owlcation.com uses cookies (and other similar technologies) and may collect, process, and share personal data. Please choose which areas of our service you consent to our doing so.

      For more information on managing or withdrawing consents and how we handle data, visit our Privacy Policy at: "https://owlcation.com/privacy-policy#gdpr"

      Show Details
      Necessary
      HubPages Device IDThis is used to identify particular browsers or devices when the access the service, and is used for security reasons.
      LoginThis is necessary to sign in to the HubPages Service.
      Google RecaptchaThis is used to prevent bots and spam. (Privacy Policy)
      AkismetThis is used to detect comment spam. (Privacy Policy)
      HubPages Google AnalyticsThis is used to provide data on traffic to our website, all personally identifyable data is anonymized. (Privacy Policy)
      HubPages Traffic PixelThis is used to collect data on traffic to articles and other pages on our site. Unless you are signed in to a HubPages account, all personally identifiable information is anonymized.
      Amazon Web ServicesThis is a cloud services platform that we used to host our service. (Privacy Policy)
      CloudflareThis is a cloud CDN service that we use to efficiently deliver files required for our service to operate such as javascript, cascading style sheets, images, and videos. (Privacy Policy)
      Google Hosted LibrariesJavascript software libraries such as jQuery are loaded at endpoints on the googleapis.com or gstatic.com domains, for performance and efficiency reasons. (Privacy Policy)
      Features
      Google Custom SearchThis is feature allows you to search the site. (Privacy Policy)
      Google MapsSome articles have Google Maps embedded in them. (Privacy Policy)
      Google ChartsThis is used to display charts and graphs on articles and the author center. (Privacy Policy)
      Google AdSense Host APIThis service allows you to sign up for or associate a Google AdSense account with HubPages, so that you can earn money from ads on your articles. No data is shared unless you engage with this feature. (Privacy Policy)
      Google YouTubeSome articles have YouTube videos embedded in them. (Privacy Policy)
      VimeoSome articles have Vimeo videos embedded in them. (Privacy Policy)
      PaypalThis is used for a registered author who enrolls in the HubPages Earnings program and requests to be paid via PayPal. No data is shared with Paypal unless you engage with this feature. (Privacy Policy)
      Facebook LoginYou can use this to streamline signing up for, or signing in to your Hubpages account. No data is shared with Facebook unless you engage with this feature. (Privacy Policy)
      MavenThis supports the Maven widget and search functionality. (Privacy Policy)
      Marketing
      Google AdSenseThis is an ad network. (Privacy Policy)
      Google DoubleClickGoogle provides ad serving technology and runs an ad network. (Privacy Policy)
      Index ExchangeThis is an ad network. (Privacy Policy)
      SovrnThis is an ad network. (Privacy Policy)
      Facebook AdsThis is an ad network. (Privacy Policy)
      Amazon Unified Ad MarketplaceThis is an ad network. (Privacy Policy)
      AppNexusThis is an ad network. (Privacy Policy)
      OpenxThis is an ad network. (Privacy Policy)
      Rubicon ProjectThis is an ad network. (Privacy Policy)
      TripleLiftThis is an ad network. (Privacy Policy)
      Say MediaWe partner with Say Media to deliver ad campaigns on our sites. (Privacy Policy)
      Remarketing PixelsWe may use remarketing pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to advertise the HubPages Service to people that have visited our sites.
      Conversion Tracking PixelsWe may use conversion tracking pixels from advertising networks such as Google AdWords, Bing Ads, and Facebook in order to identify when an advertisement has successfully resulted in the desired action, such as signing up for the HubPages Service or publishing an article on the HubPages Service.
      Statistics
      Author Google AnalyticsThis is used to provide traffic data and reports to the authors of articles on the HubPages Service. (Privacy Policy)
      ComscoreComScore is a media measurement and analytics company providing marketing data and analytics to enterprises, media and advertising agencies, and publishers. Non-consent will result in ComScore only processing obfuscated personal data. (Privacy Policy)
      Amazon Tracking PixelSome articles display amazon products as part of the Amazon Affiliate program, this pixel provides traffic statistics for those products (Privacy Policy)